Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 2825999
End position: 2826025
Length: 27

DNA sequence
>NC_017297, from 2825999 to 2826025 (27 bp); Clostridium botulinum F str. 230613 TTTTGCTTTATTTGCTTTTTTTACTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2825535-2826134	Sequence	CBF_2685 - V-type ATPase, E subunit (Protein is coded in complementary strand; from 2826134 to 2825535)