Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 3261254
End position: 3261280
Length: 27

DNA sequence
>NC_017297, from 3261254 to 3261280 (27 bp); Clostridium botulinum F str. 230613 GTAGGTATAGTAGGTGTAGTAGGTGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3260486-3261835	Sequence	CBF_3073 - hypothetical protein (Protein is coded in complementary strand; from 3261835 to 3260486)