Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 1030537
End position: 1030566
Length: 30

DNA sequence
>NC_017297, from 1030537 to 1030566 (30 bp); Clostridium botulinum F str. 230613 ATCATCATAATCATCATTATCATTATCATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1030400-1030729	Sequence	CBF_0956 - hypothetical protein (Protein is coded in complementary strand; from 1030729 to 1030400)