Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 2108078
End position: 2108107
Length: 30

DNA sequence
>NC_017297, from 2108078 to 2108107 (30 bp); Clostridium botulinum F str. 230613 ATTGTTTTTTATTCTTTATTATTCTTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2106955-2108415	Sequence	CBF_1973 - sensor histidine kinase (Protein is coded in complementary strand; from 2108415 to 2106955)