Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 2919392
End position: 2919421
Length: 30

DNA sequence
>NC_017297, from 2919392 to 2919421 (30 bp); Clostridium botulinum F str. 230613 TGTGATCTTTTGAGAACTTTTGAGGTCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2918551-2919546	Sequence	CBF_2786 fliM flagellar motor switch protein FliM (Protein is coded in complementary strand; from 2919546 to 2918551)