Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 3743866
End position: 3743895
Length: 30

DNA sequence
>NC_017297, from 3743866 to 3743895 (30 bp); Clostridium botulinum F str. 230613 TTTTAATATATTGTAATTTATTTTAAAATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3742655-3744157	Sequence	CBF_3567 - carbohydrate kinase family protein (Protein is coded in complementary strand; from 3744157 to 3742655)