Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 3230773
End position: 3230805
Length: 33

DNA sequence
>NC_017297, from 3230773 to 3230805 (33 bp); Clostridium botulinum F str. 230613 TTTCTTAATTTTTTATTTATTTTTTCTTTATTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 3230790-3231053	Sequence	CBF_3041 minE cell division topological specificity factor MinE (Protein is coded in complementary strand; from 3231053 to 3230790)