Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 3465721
End position: 3465753
Length: 33

DNA sequence
>NC_017297, from 3465721 to 3465753 (33 bp); Clostridium botulinum F str. 230613 TTAGTTCCTTTAAAGTTCCTTTTTAATTCTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3465559-3469851	Sequence	CBF_3301 - putative CoA-substrate-specific enzyme activase (Protein is coded in complementary strand; from 3469851 to 3465559)