Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 2476332
End position: 2476367
Length: 36

DNA sequence
>NC_017297, from 2476332 to 2476367 (36 bp); Clostridium botulinum F str. 230613 TTCTTTCGCACTCTCTTTCGCACTCTCTTTCACACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2476126-2476365	Sequence	CBF_2312 - hypothetical protein (Protein is coded in complementary strand; from 2476365 to 2476126)