Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 3880955
End position: 3880990
Length: 36

DNA sequence
>NC_017297, from 3880955 to 3880990 (36 bp); Clostridium botulinum F str. 230613 CTCCTGCAGCTGCTCCTATAGCTGCTCCTCCTGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3880000-3881535	Sequence	CBF_3723 spoVB-2 stage V sporulation protein B (Protein is coded in complementary strand; from 3881535 to 3880000)