Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 439696
End position: 439737
Length: 42

DNA sequence
>NC_017297, from 439696 to 439737 (42 bp); Clostridium botulinum F str. 230613 GGACAGAGTATAGAGTACAGAGTAAAGAGTACAGAGTAAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 439127-439696	Sequence	CBF_0415 - RnfABCDGE type electron transport complex subunit B