Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 3778131
End position: 3778175
Length: 45

DNA sequence
>NC_017297, from 3778131 to 3778175 (45 bp); Clostridium botulinum F str. 230613 TTTCTTGTTTTTTTGTCTCTGTTTTTTTTGCTTCTTCTTTTTTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3777602-3778855	Sequence	CBF_3603 - hypothetical protein (Protein is coded in complementary strand; from 3778855 to 3777602)