Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 3525163
End position: 3525210
Length: 48

DNA sequence
>NC_017297, from 3525163 to 3525210 (48 bp); Clostridium botulinum F str. 230613 AAATTTTTATTCATATTATTATTCATATTATTATTCACATTGTTATTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3525016-3525435	Sequence	CBF_3354 - hypothetical protein (Protein is coded in complementary strand; from 3525435 to 3525016)