Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 2688451
End position: 2688513
Length: 63

DNA sequence
>NC_017297, from 2688451 to 2688513 (63 bp); Clostridium botulinum F str. 230613 TTTCATCTTCTTCATCTTCATACTCATCCTCTTCATATTCATCATCATCTTCTTCATACTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2687475-2689433	Sequence	CBF_2555 - histidine kinase (Protein is coded in complementary strand; from 2689433 to 2687475)