Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 3459025
End position: 3459096
Length: 72

DNA sequence
>NC_017297, from 3459025 to 3459096 (72 bp); Clostridium botulinum F str. 230613 TCTTTCTTTTTCTCTAACTCTGTATCTTTCTCTATATCTAACTCTATATCTATCTCTTTCTCTAACTCTA TC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3458689-3459525	Sequence	CBF_3288 - hypothetical protein (Protein is coded in complementary strand; from 3459525 to 3458689)