Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 598150
End position: 598221
Length: 72

DNA sequence
>NC_017297, from 598150 to 598221 (72 bp); Clostridium botulinum F str. 230613 ATCTTTAGAACTAGAACTAGAACTAGAACTAGAACTAGAACTAGAACTAGAACTAGAACTAGAACTAGAA CT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 597344-598654	Sequence	CBF_0546 - hypothetical protein (Protein is coded in complementary strand; from 598654 to 597344)