Sequence retrieval

Genome: Enterococcus faecalis 62
Start position: 1037941
End position: 1037985
Length: 45

DNA sequence
>NC_017312, from 1037941 to 1037985 (45 bp); Enterococcus faecalis 62 AGAGTCGCTTGTTTTGGTATCGCTTGTTTTAGAATCACTTGATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1037891-1038919	Sequence	EF62_1057 - Peptidyl-prolyl cis-trans isomerase PPIASE domain protein (Protein is coded in complementary strand; from 1038919 to 1037891)