Sequence retrieval

Genome: Enterococcus faecalis 62
Start position: 1971439
End position: 1971465
Length: 27

DNA sequence
>NC_017312, from 1971439 to 1971465 (27 bp); Enterococcus faecalis 62 TTTTAAATCTTTTAATTCTTTTAAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1970978-1971901	Sequence	EF62_1988 phnD phosphate/phosphite/phosphonate ABC transporter, periplasmic binding family protein (Protein is coded in complementary strand; from 1971901 to 1970978)