Sequence retrieval

Genome: Enterococcus faecalis 62
Start position: 2055484
End position: 2055513
Length: 30

DNA sequence
>NC_017312, from 2055484 to 2055513 (30 bp); Enterococcus faecalis 62 TTTTTTTCTTTTTCTTCTTTTTGTTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2055480-2056898	Sequence	EF62_2076 ffh signal recognition particle protein (Protein is coded in complementary strand; from 2056898 to 2055480)