Sequence retrieval

Genome: Enterococcus faecalis 62
Start position: 2185797
End position: 2185829
Length: 33

DNA sequence
>NC_017312, from 2185797 to 2185829 (33 bp); Enterococcus faecalis 62 TAAACAATAAATAAACAGTAAGGAAACAATAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2184820-2186082	Sequence	EF62_2199 - PTS system, lactose/cellobiose family IIC component family protein (Protein is coded in complementary strand; from 2186082 to 2184820)