Sequence retrieval

Genome: Enterococcus faecalis 62
Start position: 2196623
End position: 2196647
Length: 25

DNA sequence
>NC_017312, from 2196623 to 2196647 (25 bp); Enterococcus faecalis 62 TTAATTTAAGTTCATTTATTTTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2196274-2196849	Sequence	EF62_2208 - polysaccharidase protein (Protein is coded in complementary strand; from 2196849 to 2196274)