Sequence retrieval

Genome: Enterococcus faecalis 62
Start position: 222542
End position: 222565
Length: 24

DNA sequence
>NC_017312, from 222542 to 222565 (24 bp); Enterococcus faecalis 62 CGTCATCGTAATCGTCATCATCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 222535-223371	Sequence	EF62_0209 - PTS system transporter subunit IIC (Protein is coded in complementary strand; from 223371 to 222535)