Sequence retrieval

Genome: Enterococcus faecalis 62
Start position: 2269827
End position: 2269861
Length: 35

DNA sequence
>NC_017312, from 2269827 to 2269861 (35 bp); Enterococcus faecalis 62 TTTTTTTGTTCTTTTTTTGTTTTTTCTTTTTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2269154-2269999	Sequence	EF62_2291 - hypothetical protein (Protein is coded in complementary strand; from 2269999 to 2269154)