Sequence retrieval

Genome: Enterococcus faecalis 62
Start position: 228842
End position: 228874
Length: 33

DNA sequence
>NC_017312, from 228842 to 228874 (33 bp); Enterococcus faecalis 62 TCTTACTTTTTTCTTCTTTTTTTCTTACTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 228845-229561	Sequence	EF62_0214 - hypothetical protein (Protein is coded in complementary strand; from 229561 to 228845)