Sequence retrieval

Genome: Enterococcus faecalis 62
Start position: 2356616
End position: 2356660
Length: 45

DNA sequence
>NC_017312, from 2356616 to 2356660 (45 bp); Enterococcus faecalis 62 TTTTTGTTTACTTTACTTTTATTTACTTTACTTTCCTTTACTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2356130-2357092	Sequence	EF62_2390 - DnaD and phage-associated domain protein (Protein is coded in complementary strand; from 2357092 to 2356130)