Sequence retrieval

Genome: Enterococcus faecalis 62
Start position: 2707039
End position: 2707062
Length: 24

DNA sequence
>NC_017312, from 2707039 to 2707062 (24 bp); Enterococcus faecalis 62 ATTGGTATTGGCATTGCTTTTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2706977-2707684	Sequence	EF62_2716 azlC LIV-E family branched chain amino acid exporter AzlC