Sequence retrieval

Genome: Enterococcus faecalis 62
Start position: 2799832
End position: 2799855
Length: 24

DNA sequence
>NC_017312, from 2799832 to 2799855 (24 bp); Enterococcus faecalis 62 TTTTTGTTTTTATGTTTTTTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2799151-2799861	Sequence	EF62_2804 - hypothetical protein (Protein is coded in complementary strand; from 2799861 to 2799151)