Sequence retrieval

Genome: Enterococcus faecalis 62
Start position: 2816117
End position: 2816141
Length: 25

DNA sequence
>NC_017312, from 2816117 to 2816141 (25 bp); Enterococcus faecalis 62 TTTTTTATTTATTTTTTTTGTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2816126-2817331	Sequence	EF62_2819 murM Peptidoglycan interpeptide bridge formation enzyme (Protein is coded in complementary strand; from 2817331 to 2816126)