Sequence retrieval

Genome: Enterococcus faecalis 62
Start position: 303234
End position: 303260
Length: 27

DNA sequence
>NC_017312, from 303234 to 303260 (27 bp); Enterococcus faecalis 62 TTTTTCAATTTTATCAATTTCTTCAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 302779-305721	Sequence	EF62_0287 - sulfatase family protein (Protein is coded in complementary strand; from 305721 to 302779)