Sequence retrieval

Genome: Enterococcus faecalis 62
Start position: 489542
End position: 489577
Length: 36

DNA sequence
>NC_017312, from 489542 to 489577 (36 bp); Enterococcus faecalis 62 CCAAAACCAGATCCAAAACCAGATCCAAAACCAGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 485841-489806	Sequence	EF62_0447 - LPXTG-motif cell wall anchor domain-containing protein