Sequence retrieval

Genome: Enterococcus faecalis OG1RF
Start position: 1468855
End position: 1468884
Length: 30

DNA sequence
>NC_017316, from 1468855 to 1468884 (30 bp); Enterococcus faecalis OG1RF TTTTTTTCTTTTTCTTCTTTTTGTTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1468851-1470269	Sequence	OG1RF_11411 ffh signal recognition particle protein (Protein is coded in complementary strand; from 1470269 to 1468851)