Sequence retrieval

Genome: Enterococcus faecalis OG1RF
Start position: 1621706
End position: 1621750
Length: 45

DNA sequence
>NC_017316, from 1621706 to 1621750 (45 bp); Enterococcus faecalis OG1RF ATATCCTCTTCAGTTATATCGTTTTCAGTTACATCGTCCTCAGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1621703-1622149	Sequence	OG1RF_11552 - PTS family porter, mannose/fructose-specific component IIA (Protein is coded in complementary strand; from 1622149 to 1621703)