Sequence retrieval

Genome: Enterococcus faecalis OG1RF
Start position: 1655285
End position: 1655319
Length: 35

DNA sequence
>NC_017316, from 1655285 to 1655319 (35 bp); Enterococcus faecalis OG1RF TTTTTTTGTTCTTTTTTTGTTTTTTCTTTTTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1654612-1655457	Sequence	OG1RF_11588 - hypothetical protein (Protein is coded in complementary strand; from 1655457 to 1654612)