Sequence retrieval

Genome: Enterococcus faecalis OG1RF
Start position: 2035454
End position: 2035477
Length: 24

DNA sequence
>NC_017316, from 2035454 to 2035477 (24 bp); Enterococcus faecalis OG1RF ATTGGTATTGGCATTGCTTTTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2035392-2036099	Sequence	OG1RF_11927 azlC LIV-E family branched chain amino acid exporter AzlC