Sequence retrieval

Genome: Enterococcus faecalis OG1RF
Start position: 204792
End position: 204818
Length: 27

DNA sequence
>NC_017316, from 204792 to 204818 (27 bp); Enterococcus faecalis OG1RF ACGTGGCGGACGTGGCGGACGTCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 204344-204823	Sequence	OG1RF_10206 - S1 RNA-binding domain protein
ORF... 204804-206297	Sequence	OG1RF_10207 - tRNA(Ile)-lysidine synthase