Sequence retrieval

Genome: Enterococcus faecalis OG1RF
Start position: 2128253
End position: 2128276
Length: 24

DNA sequence
>NC_017316, from 2128253 to 2128276 (24 bp); Enterococcus faecalis OG1RF TTTTTGTTTTTATGTTTTTTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2127572-2128306	Sequence	OG1RF_12015 - hypothetical protein (Protein is coded in complementary strand; from 2128306 to 2127572)