Sequence retrieval

Genome: Enterococcus faecalis OG1RF
Start position: 2144539
End position: 2144563
Length: 25

DNA sequence
>NC_017316, from 2144539 to 2144563 (25 bp); Enterococcus faecalis OG1RF TTTTTTATTTATTTTTTTTGTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2144548-2145753	Sequence	OG1RF_12030 fibA beta-lactam resistance factor (Protein is coded in complementary strand; from 2145753 to 2144548)