Sequence retrieval

Genome: Enterococcus faecalis OG1RF
Start position: 2167924
End position: 2167948
Length: 25

DNA sequence
>NC_017316, from 2167924 to 2167948 (25 bp); Enterococcus faecalis OG1RF TTTTTTTTATTTATTTTTTTGTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2167931-2168956	Sequence	OG1RF_12051 - hypothetical protein (Protein is coded in complementary strand; from 2168956 to 2167931)