Sequence retrieval

Genome: Enterococcus faecalis OG1RF
Start position: 2538845
End position: 2538868
Length: 24

DNA sequence
>NC_017316, from 2538845 to 2538868 (24 bp); Enterococcus faecalis OG1RF CGTCATCGTAATCGTCATCATCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2538838-2539674	Sequence	OG1RF_12402 sorC PTS family mannose/fructose/sorbose porter component IIC (Protein is coded in complementary strand; from 2539674 to 2538838)