Sequence retrieval

Genome: Enterococcus faecalis OG1RF
Start position: 2545143
End position: 2545175
Length: 33

DNA sequence
>NC_017316, from 2545143 to 2545175 (33 bp); Enterococcus faecalis OG1RF TCTTACTTTTTTCTTCTTTTTTTCTTACTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2545146-2545862	Sequence	OG1RF_12408 - hypothetical protein (Protein is coded in complementary strand; from 2545862 to 2545146)