Sequence retrieval

Genome: Enterococcus faecalis OG1RF
Start position: 2620007
End position: 2620033
Length: 27

DNA sequence
>NC_017316, from 2620007 to 2620033 (27 bp); Enterococcus faecalis OG1RF TTTTTCAATTTTATCAATTTCTTCAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2619552-2622569	Sequence	OG1RF_12485 - phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase (Protein is coded in complementary strand; from 2622569 to 2619552)