Sequence retrieval

Genome: Enterococcus faecalis OG1RF
Start position: 439288
End position: 439332
Length: 45

DNA sequence
>NC_017316, from 439288 to 439332 (45 bp); Enterococcus faecalis OG1RF AGAGTCGCTTGTTTTGGTATCGCTTGTTTTAGAATCACTTGATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 439238-440266	Sequence	OG1RF_10423 prsA peptidyl-prolyl cis-trans isomerase (Protein is coded in complementary strand; from 440266 to 439238)