Sequence retrieval

Genome: Enterococcus faecalis OG1RF
Start position: 504228
End position: 504252
Length: 25

DNA sequence
>NC_017316, from 504228 to 504252 (25 bp); Enterococcus faecalis OG1RF TTTTTTTGTTTATTTTTTTGTCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 504238-504375	Sequence	OG1RF_10484 - hypothetical protein (Protein is coded in complementary strand; from 504375 to 504238)