Sequence retrieval

Genome: Enterococcus faecalis OG1RF
Start position: 964269
End position: 964295
Length: 27

DNA sequence
>NC_017316, from 964269 to 964295 (27 bp); Enterococcus faecalis OG1RF GATGATGAAGAAGATGAAGATGAAGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 963823-964449	Sequence	OG1RF_10923 rpoE DNA-directed RNA polymerase sigma subunit RpoE