Sequence retrieval

Genome: Helicobacter pylori F30
Start position: 467033
End position: 467056
Length: 24

DNA sequence
>NC_017365, from 467033 to 467056 (24 bp); Helicobacter pylori F30 GCGTTTGCGTTGGCGCTTGCGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 465509-467086	Sequence	HPF30_0433 - hypothetical protein (Protein is coded in complementary strand; from 467086 to 465509)