Sequence retrieval

Genome: Helicobacter pylori F30
Start position: 1051646
End position: 1051672
Length: 27

DNA sequence
>NC_017365, from 1051646 to 1051672 (27 bp); Helicobacter pylori F30 TCCCATCGGTCCCATCAGTCCCATCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1051330-1051716	Sequence	HPF30_0981 - hypothetical protein (Protein is coded in complementary strand; from 1051716 to 1051330)