Sequence retrieval

Genome: Helicobacter pylori F30
Start position: 1081423
End position: 1081449
Length: 27

DNA sequence
>NC_017365, from 1081423 to 1081449 (27 bp); Helicobacter pylori F30 GATATTAGGGATATTGGGGATATTAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1080218-1081789	Sequence	HPF30_1012 - hypothetical protein (Protein is coded in complementary strand; from 1081789 to 1080218)