Sequence retrieval

Genome: Helicobacter pylori F30
Start position: 1285865
End position: 1285891
Length: 27

DNA sequence
>NC_017365, from 1285865 to 1285891 (27 bp); Helicobacter pylori F30 ATATTTTGAATATTTTTAATATTTTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1285028-1286551	Sequence	HPF30_1209 - hypothetical protein (Protein is coded in complementary strand; from 1286551 to 1285028)