Sequence retrieval

Genome: Helicobacter pylori F30
Start position: 1296439
End position: 1296465
Length: 27

DNA sequence
>NC_017365, from 1296439 to 1296465 (27 bp); Helicobacter pylori F30 CCCCATATCCCCCATGTCTCCCATATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1296434-1298182	Sequence	HPF30_1219 - hypothetical protein (Protein is coded in complementary strand; from 1298182 to 1296434)