Sequence retrieval

Genome: Helicobacter pylori F30
Start position: 464558
End position: 464602
Length: 45

DNA sequence
>NC_017365, from 464558 to 464602 (45 bp); Helicobacter pylori F30 TTTTTGATCAAGCGGTTTTTGATCAAGGGGCTTTTGATCAAGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 464469-465458	Sequence	HPF30_0432 flgD flagellar basal body rod modification protein (Protein is coded in complementary strand; from 465458 to 464469)